Transcript: Mouse XM_006511572.2

PREDICTED: Mus musculus glucuronyl C5-epimerase (Glce), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Glce (93683)
Length:
4868
CDS:
249..2105

Additional Resources:

NCBI RefSeq record:
XM_006511572.2
NBCI Gene record:
Glce (93683)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099236 CGCGGCATGGAATCTCTTAAA pLKO.1 1869 CDS 100% 13.200 18.480 N Glce n/a
2 TRCN0000349092 CGCGGCATGGAATCTCTTAAA pLKO_005 1869 CDS 100% 13.200 18.480 N Glce n/a
3 TRCN0000099235 GCTGCATTTCATTTCATACTA pLKO.1 2846 3UTR 100% 5.625 4.500 N Glce n/a
4 TRCN0000316327 GCTGCATTTCATTTCATACTA pLKO_005 2846 3UTR 100% 5.625 4.500 N Glce n/a
5 TRCN0000099239 CCACCAATGTTAAACAGTTTA pLKO.1 1051 CDS 100% 13.200 9.240 N Glce n/a
6 TRCN0000316328 CCACCAATGTTAAACAGTTTA pLKO_005 1051 CDS 100% 13.200 9.240 N Glce n/a
7 TRCN0000099238 GCAAGGTGTTAGGGCTCAAAT pLKO.1 538 CDS 100% 13.200 9.240 N Glce n/a
8 TRCN0000316263 GCAAGGTGTTAGGGCTCAAAT pLKO_005 538 CDS 100% 13.200 9.240 N Glce n/a
9 TRCN0000099237 GCATGGAGTTAAAGCCGTGTT pLKO.1 1700 CDS 100% 4.050 2.835 N Glce n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.