Transcript: Mouse XM_006511606.3

PREDICTED: Mus musculus predicted gene 10634 (Gm10634), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm10634 (100039674)
Length:
1912
CDS:
593..1774

Additional Resources:

NCBI RefSeq record:
XM_006511606.3
NBCI Gene record:
Gm10634 (100039674)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511606.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183612 GATGTGTTTCTGCAATCTTAA pLKO.1 621 CDS 100% 13.200 6.600 Y 4930579C12Rik n/a
2 TRCN0000179355 GCTCACCTTTCTTGAGAAATA pLKO.1 417 5UTR 100% 13.200 6.600 Y 4930579C12Rik n/a
3 TRCN0000183135 CCGGAACATATTTACAATCAT pLKO.1 205 5UTR 100% 5.625 2.813 Y 4930579C12Rik n/a
4 TRCN0000179246 GCACCTGAAATTAAGGAGATA pLKO.1 1286 CDS 100% 4.950 2.475 Y 4930579C12Rik n/a
5 TRCN0000183959 CCAAAGAAACAGCACCCGTTA pLKO.1 711 CDS 100% 4.050 2.025 Y 4930579C12Rik n/a
6 TRCN0000184736 CCCGTTACAACAGAAGTGGTA pLKO.1 725 CDS 100% 2.640 1.320 Y 4930579C12Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511606.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.