Transcript: Mouse XM_006511878.2

PREDICTED: Mus musculus ring finger protein 123 (Rnf123), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf123 (84585)
Length:
4862
CDS:
732..4694

Additional Resources:

NCBI RefSeq record:
XM_006511878.2
NBCI Gene record:
Rnf123 (84585)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346892 TCGAATAGTAGGCACTGATAT pLKO_005 3482 CDS 100% 13.200 18.480 N Rnf123 n/a
2 TRCN0000200959 CCAAAGACTCAAGAAACGCAT pLKO.1 2201 CDS 100% 2.640 3.696 N Rnf123 n/a
3 TRCN0000346964 ATGTTACCACCACGAATTATG pLKO_005 1276 CDS 100% 13.200 10.560 N Rnf123 n/a
4 TRCN0000217438 GACATTGTCAGCTGCCTAATT pLKO.1 1317 CDS 100% 13.200 10.560 N Rnf123 n/a
5 TRCN0000346962 TCTACCGATTCTCGCCTATTG pLKO_005 1894 CDS 100% 10.800 8.640 N Rnf123 n/a
6 TRCN0000346891 ACCATCAACTGCCGCTTTAAT pLKO_005 1188 CDS 100% 15.000 10.500 N Rnf123 n/a
7 TRCN0000201178 GCGCTTCTATTGGGATGAATA pLKO.1 2426 CDS 100% 13.200 9.240 N Rnf123 n/a
8 TRCN0000191626 GAAACCGCTAAACTTCCATAA pLKO.1 899 CDS 100% 10.800 7.560 N Rnf123 n/a
9 TRCN0000346890 GAAACCGCTAAACTTCCATAA pLKO_005 899 CDS 100% 10.800 7.560 N Rnf123 n/a
10 TRCN0000190349 CAGCAGGAAACCGCTAAACTT pLKO.1 893 CDS 100% 5.625 3.938 N Rnf123 n/a
11 TRCN0000201651 CCGTTCTACCACATGTGTGTA pLKO.1 1103 CDS 100% 4.950 3.465 N Rnf123 n/a
12 TRCN0000192171 CTCGAATAGTAGGCACTGATA pLKO.1 3481 CDS 100% 4.950 3.465 N Rnf123 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.