Transcript: Mouse XM_006511879.3

PREDICTED: Mus musculus ring finger protein 123 (Rnf123), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf123 (84585)
Length:
4845
CDS:
715..4677

Additional Resources:

NCBI RefSeq record:
XM_006511879.3
NBCI Gene record:
Rnf123 (84585)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511879.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346892 TCGAATAGTAGGCACTGATAT pLKO_005 3465 CDS 100% 13.200 18.480 N Rnf123 n/a
2 TRCN0000200959 CCAAAGACTCAAGAAACGCAT pLKO.1 2184 CDS 100% 2.640 3.696 N Rnf123 n/a
3 TRCN0000346964 ATGTTACCACCACGAATTATG pLKO_005 1259 CDS 100% 13.200 10.560 N Rnf123 n/a
4 TRCN0000217438 GACATTGTCAGCTGCCTAATT pLKO.1 1300 CDS 100% 13.200 10.560 N Rnf123 n/a
5 TRCN0000346962 TCTACCGATTCTCGCCTATTG pLKO_005 1877 CDS 100% 10.800 8.640 N Rnf123 n/a
6 TRCN0000346891 ACCATCAACTGCCGCTTTAAT pLKO_005 1171 CDS 100% 15.000 10.500 N Rnf123 n/a
7 TRCN0000201178 GCGCTTCTATTGGGATGAATA pLKO.1 2409 CDS 100% 13.200 9.240 N Rnf123 n/a
8 TRCN0000191626 GAAACCGCTAAACTTCCATAA pLKO.1 882 CDS 100% 10.800 7.560 N Rnf123 n/a
9 TRCN0000346890 GAAACCGCTAAACTTCCATAA pLKO_005 882 CDS 100% 10.800 7.560 N Rnf123 n/a
10 TRCN0000190349 CAGCAGGAAACCGCTAAACTT pLKO.1 876 CDS 100% 5.625 3.938 N Rnf123 n/a
11 TRCN0000201651 CCGTTCTACCACATGTGTGTA pLKO.1 1086 CDS 100% 4.950 3.465 N Rnf123 n/a
12 TRCN0000192171 CTCGAATAGTAGGCACTGATA pLKO.1 3464 CDS 100% 4.950 3.465 N Rnf123 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511879.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.