Transcript: Mouse XM_006512250.2

PREDICTED: Mus musculus zinc finger, DHHC domain containing 3 (Zdhhc3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zdhhc3 (69035)
Length:
4604
CDS:
116..1045

Additional Resources:

NCBI RefSeq record:
XM_006512250.2
NBCI Gene record:
Zdhhc3 (69035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120663 GCGGAGTTTGTAGTCCTCTTT pLKO.1 287 CDS 100% 4.950 3.465 N Zdhhc3 n/a
2 TRCN0000345153 GCGGAGTTTGTAGTCCTCTTT pLKO_005 287 CDS 100% 4.950 3.465 N Zdhhc3 n/a
3 TRCN0000120665 GCCATGTGGTTTATCCGAGAT pLKO.1 218 CDS 100% 4.050 2.835 N Zdhhc3 n/a
4 TRCN0000345216 GCCATGTGGTTTATCCGAGAT pLKO_005 218 CDS 100% 4.050 2.835 N Zdhhc3 n/a
5 TRCN0000120666 GCTTTGAAGAAGACTGGACAA pLKO.1 636 CDS 100% 4.050 2.835 N Zdhhc3 n/a
6 TRCN0000345155 GCTTTGAAGAAGACTGGACAA pLKO_005 636 CDS 100% 4.050 2.835 N Zdhhc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.