Transcript: Mouse XM_006512262.2

PREDICTED: Mus musculus CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like (Ctdspl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ctdspl (69274)
Length:
4347
CDS:
80..877

Additional Resources:

NCBI RefSeq record:
XM_006512262.2
NBCI Gene record:
Ctdspl (69274)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512262.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313278 CAGCGCAACATCAGCCTAAAG pLKO_005 164 CDS 100% 10.800 8.640 N Ctdspl n/a
2 TRCN0000313279 AGTGATCATCGTGGACAATTC pLKO_005 697 CDS 100% 10.800 7.560 N Ctdspl n/a
3 TRCN0000125468 CCAGCGCAACATCAGCCTAAA pLKO.1 163 CDS 100% 10.800 7.560 N Ctdspl n/a
4 TRCN0000313341 TTTACGGTCTTAGATACTTAC pLKO_005 1376 3UTR 100% 10.800 7.560 N Ctdspl n/a
5 TRCN0000125465 GCCCATTAGTAATGCTGACTT pLKO.1 415 CDS 100% 4.950 3.465 N Ctdspl n/a
6 TRCN0000349377 GCCCATTAGTAATGCTGACTT pLKO_005 415 CDS 100% 4.950 3.465 N Ctdspl n/a
7 TRCN0000125467 CTTCAGAGAATCCTGCGTGTT pLKO.1 622 CDS 100% 4.050 2.835 N Ctdspl n/a
8 TRCN0000125464 GCAGTCAACATCAGAGCCTAA pLKO.1 2144 3UTR 100% 4.050 2.835 N Ctdspl n/a
9 TRCN0000125466 CCACCAGCTAAATACCTCCTT pLKO.1 314 CDS 100% 2.640 1.848 N Ctdspl n/a
10 TRCN0000382179 GAAATGTGTGGTCATTGATTT pLKO_005 364 CDS 100% 13.200 9.240 N CTDSPL n/a
11 TRCN0000314821 AGCTGAGCAAAGTGATCATTG pLKO_005 687 CDS 100% 10.800 7.560 N CTDSPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512262.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.