Transcript: Mouse XM_006512631.1

PREDICTED: Mus musculus single-minded homolog 1 (Drosophila) (Sim1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sim1 (20464)
Length:
6641
CDS:
120..1826

Additional Resources:

NCBI RefSeq record:
XM_006512631.1
NBCI Gene record:
Sim1 (20464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512631.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432952 ACGAATTGTCCTGTGCGTATA pLKO_005 814 CDS 100% 10.800 15.120 N Sim1 n/a
2 TRCN0000419824 CCACTGCACTGTCTCGGATAA pLKO_005 1480 CDS 100% 10.800 15.120 N Sim1 n/a
3 TRCN0000085111 CGGGATTCCATACTGAGAGAT pLKO.1 700 CDS 100% 4.950 6.930 N Sim1 n/a
4 TRCN0000085112 CTAGTTCTGATCGCATTACAA pLKO.1 1507 CDS 100% 0.000 0.000 N Sim1 n/a
5 TRCN0000435021 CACCGACATTCAAGGTTATAC pLKO_005 1983 3UTR 100% 13.200 9.240 N Sim1 n/a
6 TRCN0000015071 CCTCACAGACACAGAATACAA pLKO.1 521 CDS 100% 5.625 3.938 N SIM1 n/a
7 TRCN0000085110 CCTTTGATGGATGCTACCAAA pLKO.1 127 CDS 100% 4.950 3.465 N Sim1 n/a
8 TRCN0000085109 GCTCTCCAGTAGCAAGTCAAA pLKO.1 650 CDS 100% 4.950 3.465 N Sim1 n/a
9 TRCN0000085108 CCACTTATTATTTCCTGGTTA pLKO.1 5036 3UTR 100% 4.950 2.970 N Sim1 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5918 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512631.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.