Transcript: Mouse XM_006512740.3

PREDICTED: Mus musculus SNF2 histone linker PHD RING helicase (Shprh), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Shprh (268281)
Length:
9261
CDS:
186..5210

Additional Resources:

NCBI RefSeq record:
XM_006512740.3
NBCI Gene record:
Shprh (268281)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512740.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084265 CGTGGCAAGATGTATTAGATA pLKO.1 4765 CDS 100% 5.625 7.875 N Shprh n/a
2 TRCN0000298420 CGTGGCAAGATGTATTAGATA pLKO_005 4765 CDS 100% 5.625 7.875 N Shprh n/a
3 TRCN0000084266 GCAGGCATTCACATCATTAAA pLKO.1 3249 CDS 100% 15.000 10.500 N Shprh n/a
4 TRCN0000288210 GCAGGCATTCACATCATTAAA pLKO_005 3249 CDS 100% 15.000 10.500 N Shprh n/a
5 TRCN0000295572 GGTTGAACAGAATCGTATAAA pLKO_005 4310 CDS 100% 15.000 10.500 N Shprh n/a
6 TRCN0000084267 GCACTATATGAGTAAGTGTAA pLKO.1 3470 CDS 100% 4.950 3.465 N Shprh n/a
7 TRCN0000288277 GCACTATATGAGTAAGTGTAA pLKO_005 3470 CDS 100% 4.950 3.465 N Shprh n/a
8 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 8199 3UTR 100% 4.950 2.475 Y Gad2 n/a
9 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 8140 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512740.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.