Transcript: Mouse XM_006512773.3

PREDICTED: Mus musculus solute carrier family 2 (facilitated glucose transporter), member 12 (Slc2a12), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc2a12 (353169)
Length:
3062
CDS:
309..2054

Additional Resources:

NCBI RefSeq record:
XM_006512773.3
NBCI Gene record:
Slc2a12 (353169)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069720 GCAAAGGCGAACTATGTGAAA pLKO.1 1893 CDS 100% 4.950 6.930 N Slc2a12 n/a
2 TRCN0000069719 GCAAGCAATAGCGATGTACTT pLKO.1 824 CDS 100% 4.950 6.930 N Slc2a12 n/a
3 TRCN0000069722 CTGATCTTATTGGTTTGTCAT pLKO.1 1765 CDS 100% 4.950 3.960 N Slc2a12 n/a
4 TRCN0000069721 CTGATGATTGTCACTGGTATT pLKO.1 714 CDS 100% 10.800 7.560 N Slc2a12 n/a
5 TRCN0000069718 GCAGCCAAACATACTATTCTA pLKO.1 1076 CDS 100% 5.625 3.938 N Slc2a12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.