Transcript: Mouse XM_006512775.3

PREDICTED: Mus musculus solute carrier family 2 (facilitated glucose transporter), member 12 (Slc2a12), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc2a12 (353169)
Length:
2005
CDS:
463..1932

Additional Resources:

NCBI RefSeq record:
XM_006512775.3
NBCI Gene record:
Slc2a12 (353169)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069719 GCAAGCAATAGCGATGTACTT pLKO.1 1101 CDS 100% 4.950 6.930 N Slc2a12 n/a
2 TRCN0000069721 CTGATGATTGTCACTGGTATT pLKO.1 991 CDS 100% 10.800 7.560 N Slc2a12 n/a
3 TRCN0000069718 GCAGCCAAACATACTATTCTA pLKO.1 1353 CDS 100% 5.625 3.938 N Slc2a12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.