Transcript: Mouse XM_006512809.3

PREDICTED: Mus musculus vesicle (multivesicular body) trafficking 1 (Vta1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vta1 (66201)
Length:
1845
CDS:
63..905

Additional Resources:

NCBI RefSeq record:
XM_006512809.3
NBCI Gene record:
Vta1 (66201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512809.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000292570 ACTCCTGAGTGTCGTAAATTT pLKO_005 219 CDS 100% 15.000 21.000 N Vta1 n/a
2 TRCN0000183265 GTCGTTTATATGCTATGCAAA pLKO.1 175 CDS 100% 4.950 6.930 N Vta1 n/a
3 TRCN0000184802 CGTTACACTTTCCTCAGCCTT pLKO.1 955 3UTR 100% 2.640 3.696 N Vta1 n/a
4 TRCN0000292569 CGTTACACTTTCCTCAGCCTT pLKO_005 955 3UTR 100% 2.640 3.696 N Vta1 n/a
5 TRCN0000180514 GCTCAGAAGTACTGCAAGTAT pLKO.1 795 CDS 100% 5.625 3.938 N Vta1 n/a
6 TRCN0000292568 GCTCAGAAGTACTGCAAGTAT pLKO_005 795 CDS 100% 5.625 3.938 N Vta1 n/a
7 TRCN0000180296 CCAGTTGTCATTGAGTGTGTA pLKO.1 1063 3UTR 100% 4.950 3.465 N Vta1 n/a
8 TRCN0000292566 CCAGTTGTCATTGAGTGTGTA pLKO_005 1063 3UTR 100% 4.950 3.465 N Vta1 n/a
9 TRCN0000180554 GCCATCATCATCTTCAGCATA pLKO.1 638 CDS 100% 4.950 2.970 N Vta1 n/a
10 TRCN0000292567 GCCATCATCATCTTCAGCATA pLKO_005 638 CDS 100% 4.950 2.970 N Vta1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512809.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08310 pDONR223 100% 80.8% 86.3% None (many diffs) n/a
2 ccsbBroad304_08310 pLX_304 0% 80.8% 86.3% V5 (many diffs) n/a
Download CSV