Transcript: Mouse XM_006512821.1

PREDICTED: Mus musculus discoidin, CUB and LCCL domain containing 1 (Dcbld1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dcbld1 (66686)
Length:
2327
CDS:
112..945

Additional Resources:

NCBI RefSeq record:
XM_006512821.1
NBCI Gene record:
Dcbld1 (66686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098324 CGACGGAATTTACCATCAGCT pLKO.1 347 CDS 100% 2.640 2.112 N Dcbld1 n/a
2 TRCN0000098320 CCTCACTTACTGTTTACAGAA pLKO.1 1052 3UTR 100% 4.950 3.465 N Dcbld1 n/a
3 TRCN0000324631 CCTCACTTACTGTTTACAGAA pLKO_005 1052 3UTR 100% 4.950 3.465 N Dcbld1 n/a
4 TRCN0000098321 CCACTCACAAACACTCCCATT pLKO.1 692 CDS 100% 4.050 2.835 N Dcbld1 n/a
5 TRCN0000324629 CCACTCACAAACACTCCCATT pLKO_005 692 CDS 100% 4.050 2.835 N Dcbld1 n/a
6 TRCN0000098322 GCAGGAGATATTTCTGGGAAT pLKO.1 84 5UTR 100% 4.050 2.835 N Dcbld1 n/a
7 TRCN0000324630 GCAGGAGATATTTCTGGGAAT pLKO_005 84 5UTR 100% 4.050 2.835 N Dcbld1 n/a
8 TRCN0000305828 CTAGTGATATGGCAGATTATC pLKO_005 410 CDS 100% 0.000 0.000 N Dcbld1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.