Transcript: Mouse XM_006512834.3

PREDICTED: Mus musculus RIKEN cDNA 1700021F05 gene (1700021F05Rik), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
1700021F05Rik (67851)
Length:
1106
CDS:
288..1010

Additional Resources:

NCBI RefSeq record:
XM_006512834.3
NBCI Gene record:
1700021F05Rik (67851)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512834.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353429 GACATCGTCACACAAACTTTG pLKO_005 371 CDS 100% 10.800 15.120 N 1700021F05Rik n/a
2 TRCN0000328542 GTGTGGCGAAGGACTACAAAG pLKO_005 667 CDS 100% 10.800 15.120 N 1700021F05Rik n/a
3 TRCN0000179981 CGTCACACAAACTTTGTGCTT pLKO.1 376 CDS 100% 2.640 2.112 N 1700021F05Rik n/a
4 TRCN0000328600 CCAAGTTAAACACATCAAATT pLKO_005 427 CDS 100% 13.200 9.240 N 1700021F05Rik n/a
5 TRCN0000183108 CTGGAACCGATACTTGTATTT pLKO.1 398 CDS 100% 13.200 9.240 N 1700021F05Rik n/a
6 TRCN0000328538 CTGGAACCGATACTTGTATTT pLKO_005 398 CDS 100% 13.200 9.240 N 1700021F05Rik n/a
7 TRCN0000328539 AGAGAAGACTGAGAACGACAA pLKO_005 926 CDS 100% 4.050 2.835 N 1700021F05Rik n/a
8 TRCN0000179502 GAGAACAAAGAGACAGGAACA pLKO.1 867 CDS 100% 4.050 2.835 N 1700021F05Rik n/a
9 TRCN0000179806 CAAACTTTGTGCTTCCTGGAA pLKO.1 383 CDS 100% 2.640 1.848 N 1700021F05Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512834.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.