Transcript: Mouse XM_006512840.2

PREDICTED: Mus musculus SAM and SH3 domain containing 1 (Sash1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sash1 (70097)
Length:
6765
CDS:
489..3485

Additional Resources:

NCBI RefSeq record:
XM_006512840.2
NBCI Gene record:
Sash1 (70097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353377 CTGCATGTTGGCAGTAATAAT pLKO_005 1023 CDS 100% 15.000 21.000 N Sash1 n/a
2 TRCN0000121382 CGCTAGTTCATTTGGGTTATT pLKO.1 5052 3UTR 100% 13.200 18.480 N Sash1 n/a
3 TRCN0000336281 CGTCCACGGAGTCCAACTTAA pLKO_005 2017 CDS 100% 13.200 18.480 N Sash1 n/a
4 TRCN0000121386 CGCCTGTTAAACCCGGCTTAA pLKO.1 2572 CDS 100% 10.800 15.120 N Sash1 n/a
5 TRCN0000121383 CGGCACGTTCAAGTTCATCTA pLKO.1 1577 CDS 100% 4.950 6.930 N Sash1 n/a
6 TRCN0000336278 CGGCACGTTCAAGTTCATCTA pLKO_005 1577 CDS 100% 4.950 6.930 N Sash1 n/a
7 TRCN0000121384 GCTGACGGAAATCTGCAGAAA pLKO.1 3236 CDS 100% 4.950 3.960 N Sash1 n/a
8 TRCN0000336279 AGGAGATATCATTGACATAAT pLKO_005 1508 CDS 100% 13.200 9.240 N Sash1 n/a
9 TRCN0000159781 GCAGTAATAATTCTGACCCAA pLKO.1 1033 CDS 100% 2.640 3.696 N SASH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.