Transcript: Mouse XM_006512869.3

PREDICTED: Mus musculus zinc finger with UFM1-specific peptidase domain (Zufsp), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zufsp (72580)
Length:
2329
CDS:
410..2143

Additional Resources:

NCBI RefSeq record:
XM_006512869.3
NBCI Gene record:
Zufsp (72580)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241319 AGAGTAAAGTGCCGCATTATT pLKO_005 1715 CDS 100% 15.000 21.000 N Zufsp n/a
2 TRCN0000194226 GCCCAAGGATCAATTTATGAA pLKO.1 830 CDS 100% 5.625 7.875 N Zufsp n/a
3 TRCN0000129105 CCCTCGCTTATTTGAATGGAT pLKO.1 1771 CDS 100% 3.000 4.200 N ZUP1 n/a
4 TRCN0000229398 GGTACACACCCTCGCTTATTT pLKO_005 1763 CDS 100% 15.000 10.500 N ZUP1 n/a
5 TRCN0000241318 GGTACACACCCTCGCTTATTT pLKO_005 1763 CDS 100% 15.000 10.500 N Zufsp n/a
6 TRCN0000241320 TTGCAAGTTGTCAGGTATAAA pLKO_005 508 CDS 100% 15.000 10.500 N Zufsp n/a
7 TRCN0000173782 CAGAAGTTGCAGCGGCAATAT pLKO.1 1187 CDS 100% 13.200 9.240 N Zufsp n/a
8 TRCN0000241321 CATTATGCTTGCTAGTATTTG pLKO_005 1920 CDS 100% 13.200 9.240 N Zufsp n/a
9 TRCN0000130740 GCTTTCAGCAAGGCATGGATA pLKO.1 1065 CDS 100% 4.950 3.465 N ZUP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05254 pDONR223 100% 86.4% 82.5% None (many diffs) n/a
Download CSV