Transcript: Mouse XM_006513034.2

PREDICTED: Mus musculus family with sequence similarity 207, member A (Fam207a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam207a (108707)
Length:
3530
CDS:
1185..1841

Additional Resources:

NCBI RefSeq record:
XM_006513034.2
NBCI Gene record:
Fam207a (108707)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513034.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294571 CTGCCGGTGAGGACAAATAAA pLKO_005 1972 3UTR 100% 15.000 21.000 N Fam207a n/a
2 TRCN0000123615 CGTGAGCGATGGTTACAGAAA pLKO.1 1482 CDS 100% 4.950 6.930 N Fam207a n/a
3 TRCN0000317544 CGTGAGCGATGGTTACAGAAA pLKO_005 1482 CDS 100% 4.950 6.930 N Fam207a n/a
4 TRCN0000123618 GACTGGACATTCGTTCACAAT pLKO.1 1323 CDS 100% 4.950 3.960 N Fam207a n/a
5 TRCN0000298280 GACTGGACATTCGTTCACAAT pLKO_005 1323 CDS 100% 4.950 3.960 N Fam207a n/a
6 TRCN0000294504 GTGCAGAGCCAAAGGCCATTT pLKO_005 1432 CDS 100% 10.800 7.560 N Fam207a n/a
7 TRCN0000123617 CTCAGCCGAATGACCACAGTA pLKO.1 1680 CDS 100% 4.950 3.465 N Fam207a n/a
8 TRCN0000123616 TGAAGAAGAAAGGACCCGGTT pLKO.1 1718 CDS 100% 2.160 1.512 N Fam207a n/a
9 TRCN0000287100 TGAAGAAGAAAGGACCCGGTT pLKO_005 1718 CDS 100% 2.160 1.512 N Fam207a n/a
10 TRCN0000123614 GCTCTCATTAAGAGAGCCTAA pLKO.1 2941 3UTR 100% 0.405 0.284 N Fam207a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513034.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.