Transcript: Mouse XM_006513176.3

PREDICTED: Mus musculus collagen, type XVIII, alpha 1 (Col18a1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Col18a1 (12822)
Length:
5903
CDS:
307..4887

Additional Resources:

NCBI RefSeq record:
XM_006513176.3
NBCI Gene record:
Col18a1 (12822)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513176.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109536 GCTGGATTCGATGATATGGAA pLKO.1 2698 CDS 100% 3.000 4.200 N Col18a1 n/a
2 TRCN0000326587 GCTGGATTCGATGATATGGAA pLKO_005 2698 CDS 100% 3.000 4.200 N Col18a1 n/a
3 TRCN0000109538 GCGGAGACATAGAGAGCCTTA pLKO.1 2303 CDS 100% 4.050 3.240 N Col18a1 n/a
4 TRCN0000326585 GCGGAGACATAGAGAGCCTTA pLKO_005 2303 CDS 100% 4.050 3.240 N Col18a1 n/a
5 TRCN0000109539 GCACCACAGAAGATCCTAGAA pLKO.1 1778 CDS 100% 4.950 3.465 N Col18a1 n/a
6 TRCN0000326519 GCACCACAGAAGATCCTAGAA pLKO_005 1778 CDS 100% 4.950 3.465 N Col18a1 n/a
7 TRCN0000109537 CCTGTGCATTGAGAATAGCTT pLKO.1 4845 CDS 100% 3.000 2.100 N Col18a1 n/a
8 TRCN0000326517 CCTGTGCATTGAGAATAGCTT pLKO_005 4845 CDS 100% 3.000 2.100 N Col18a1 n/a
9 TRCN0000109535 GCTGGGATACAATCCTGTATA pLKO.1 4974 3UTR 100% 1.320 0.924 N Col18a1 n/a
10 TRCN0000326586 GCTGGGATACAATCCTGTATA pLKO_005 4974 3UTR 100% 1.320 0.924 N Col18a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513176.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.