Transcript: Mouse XM_006513289.2

PREDICTED: Mus musculus glutamate receptor, ionotropic, NMDA3B (Grin3b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grin3b (170483)
Length:
2583
CDS:
264..2570

Additional Resources:

NCBI RefSeq record:
XM_006513289.2
NBCI Gene record:
Grin3b (170483)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434127 GGTGCATGTGTCTCGGCATTT pLKO_005 1586 CDS 100% 10.800 15.120 N Grin3b n/a
2 TRCN0000100221 GTAAATTGTGAGGACCTGAAA pLKO.1 1464 CDS 100% 4.950 3.465 N Grin3b n/a
3 TRCN0000100223 AGTAAATTGTGAGGACCTGAA pLKO.1 1463 CDS 100% 4.050 2.835 N Grin3b n/a
4 TRCN0000100222 CCTTTGACTTTGAGCTCTATA pLKO.1 1978 CDS 100% 13.200 7.920 N Grin3b n/a
5 TRCN0000421865 ACCGTCTTCTCCTACTCCTCA pLKO_005 2337 CDS 100% 2.640 1.848 N GRIN3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.