Transcript: Mouse XM_006513394.3

PREDICTED: Mus musculus splicing factor 3a, subunit 2 (Sf3a2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sf3a2 (20222)
Length:
1768
CDS:
201..1658

Additional Resources:

NCBI RefSeq record:
XM_006513394.3
NBCI Gene record:
Sf3a2 (20222)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513394.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123662 GCCACCGTTTCATGTCTGCTT pLKO.1 643 CDS 100% 2.640 2.112 N Sf3a2 n/a
2 TRCN0000305726 TTTCTTCAGTTCCACTTTAAG pLKO_005 819 CDS 100% 13.200 9.240 N Sf3a2 n/a
3 TRCN0000305728 GCCTGACTCTGCATAACAATG pLKO_005 376 CDS 100% 10.800 7.560 N Sf3a2 n/a
4 TRCN0000305727 AGAACCACTTGGGATCCTATG pLKO_005 343 CDS 100% 6.000 4.200 N Sf3a2 n/a
5 TRCN0000123659 CCACCGTTTCATGTCTGCTTA pLKO.1 644 CDS 100% 4.950 3.465 N Sf3a2 n/a
6 TRCN0000123663 CCAGATTGACTACCCTGAGAT pLKO.1 602 CDS 100% 4.950 3.465 N Sf3a2 n/a
7 TRCN0000123660 GCCCTATGAGACCATTGCTTT pLKO.1 722 CDS 100% 4.950 3.465 N Sf3a2 n/a
8 TRCN0000123661 GACATCAACAAGGACCCGTAT pLKO.1 315 CDS 100% 4.050 2.835 N Sf3a2 n/a
9 TRCN0000324403 GACATCAACAAGGACCCGTAT pLKO_005 315 CDS 100% 4.050 2.835 N Sf3a2 n/a
10 TRCN0000311409 GGGAAGAAACATCAGACTAAC pLKO_005 423 CDS 100% 10.800 6.480 N Sf3a2 n/a
11 TRCN0000000063 ACATCAACAAGGACCCGTACT pLKO.1 316 CDS 100% 4.050 5.670 N SF3A2 n/a
12 TRCN0000320803 ACATCAACAAGGACCCGTACT pLKO_005 316 CDS 100% 4.050 5.670 N SF3A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513394.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.