Transcript: Mouse XM_006513435.1

PREDICTED: Mus musculus signal transducer and activator of transcription 2 (Stat2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stat2 (20847)
Length:
4323
CDS:
157..2844

Additional Resources:

NCBI RefSeq record:
XM_006513435.1
NBCI Gene record:
Stat2 (20847)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232257 AGGACTGGTTGGCCGATTAAC pLKO_005 717 CDS 100% 13.200 10.560 N Stat2 n/a
2 TRCN0000081539 GCCCAAGTCATGGAGTTACTT pLKO.1 970 CDS 100% 5.625 4.500 N Stat2 n/a
3 TRCN0000081538 CCGGCCAACAGGTGAAATTAA pLKO.1 4115 3UTR 100% 15.000 10.500 N Stat2 n/a
4 TRCN0000232259 GGCCAGAGACAGGGCTTAATT pLKO_005 1234 CDS 100% 15.000 10.500 N Stat2 n/a
5 TRCN0000232258 AGTCACATGCTTCGGTATAAG pLKO_005 913 CDS 100% 13.200 9.240 N Stat2 n/a
6 TRCN0000081542 GCAGCCATCAGAGTCAGATTT pLKO.1 2637 CDS 100% 13.200 9.240 N Stat2 n/a
7 TRCN0000232261 TTCAGGTTGGAACGACTTTAA pLKO_005 3125 3UTR 100% 13.200 9.240 N Stat2 n/a
8 TRCN0000232260 GATGACGATAAAGTCGAAATC pLKO_005 1924 CDS 100% 10.800 7.560 N Stat2 n/a
9 TRCN0000081541 CCCTACACCAAGGAAGTGTTA pLKO.1 1957 CDS 100% 4.950 3.465 N Stat2 n/a
10 TRCN0000081540 CGCTTCAGTGAAACTTCTGAA pLKO.1 1870 CDS 100% 0.495 0.347 N Stat2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.