Transcript: Mouse XM_006513436.1

PREDICTED: Mus musculus signal transducer and activator of transcription 2 (Stat2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stat2 (20847)
Length:
2200
CDS:
167..2104

Additional Resources:

NCBI RefSeq record:
XM_006513436.1
NBCI Gene record:
Stat2 (20847)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232257 AGGACTGGTTGGCCGATTAAC pLKO_005 817 CDS 100% 13.200 10.560 N Stat2 n/a
2 TRCN0000081539 GCCCAAGTCATGGAGTTACTT pLKO.1 1070 CDS 100% 5.625 4.500 N Stat2 n/a
3 TRCN0000232259 GGCCAGAGACAGGGCTTAATT pLKO_005 1334 CDS 100% 15.000 10.500 N Stat2 n/a
4 TRCN0000232258 AGTCACATGCTTCGGTATAAG pLKO_005 1013 CDS 100% 13.200 9.240 N Stat2 n/a
5 TRCN0000081541 CCCTACACCAAGGAAGTGTTA pLKO.1 2137 3UTR 100% 4.950 3.465 N Stat2 n/a
6 TRCN0000081540 CGCTTCAGTGAAACTTCTGAA pLKO.1 1970 CDS 100% 0.495 0.347 N Stat2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.