Transcript: Mouse XM_006513442.3

PREDICTED: Mus musculus serine/threonine kinase 11 (Stk11), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stk11 (20869)
Length:
2251
CDS:
1244..2023

Additional Resources:

NCBI RefSeq record:
XM_006513442.3
NBCI Gene record:
Stk11 (20869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285737 CATCGACTCCACCGAGGTAAT pLKO_005 929 5UTR 100% 10.800 15.120 N Stk11 n/a
2 TRCN0000221241 CCCAAGGCTGTTTGTGTGAAT pLKO.1 1880 CDS 100% 4.950 3.465 N Stk11 n/a
3 TRCN0000274660 CCCAAGGCTGTTTGTGTGAAT pLKO_005 1880 CDS 100% 4.950 3.465 N Stk11 n/a
4 TRCN0000274659 CTGAGGCCTACAGTGTGTCAT pLKO_005 2024 CDS 100% 4.950 3.465 N Stk11 n/a
5 TRCN0000221239 GACAATATCTACAAGCTCTTT pLKO.1 1484 CDS 100% 4.950 3.465 N Stk11 n/a
6 TRCN0000323452 GACAATATCTACAAGCTCTTT pLKO_005 1484 CDS 100% 4.950 3.465 N Stk11 n/a
7 TRCN0000221240 GCAGAAGATGTATATGGTGAT pLKO.1 1211 5UTR 100% 4.050 2.835 N Stk11 n/a
8 TRCN0000221242 CATCGGAATGTGATCCAGCTT pLKO.1 1164 5UTR 100% 2.640 1.848 N Stk11 n/a
9 TRCN0000024148 CGCCAAGCTCATCGGCAAGTA pLKO.1 971 5UTR 100% 1.650 1.155 N Stk11 n/a
10 TRCN0000274658 CGCCAAGCTCATCGGCAAGTA pLKO_005 971 5UTR 100% 1.650 1.155 N Stk11 n/a
11 TRCN0000199913 GCCAAGCTCATCGGCAAGTAC pLKO.1 972 5UTR 100% 1.650 1.155 N STK11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.