Transcript: Mouse XM_006513525.3

PREDICTED: Mus musculus early endosome antigen 1 (Eea1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eea1 (216238)
Length:
8023
CDS:
826..4716

Additional Resources:

NCBI RefSeq record:
XM_006513525.3
NBCI Gene record:
Eea1 (216238)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381364 TCTGGACGGCTCCTATCATTT pLKO_005 5060 3UTR 100% 13.200 18.480 N Eea1 n/a
2 TRCN0000381960 AGCAAGTGTTACGTCAGATTG pLKO_005 2015 CDS 100% 10.800 15.120 N Eea1 n/a
3 TRCN0000256425 TTCATCAGCAACTCCTATAAA pLKO_005 349 5UTR 100% 15.000 12.000 N Eea1 n/a
4 TRCN0000381204 TTCATCAGCAACTCCTATAAA pLKO_005 349 5UTR 100% 15.000 12.000 N EEA1 n/a
5 TRCN0000381287 ACTATGCAGGTCACAACATTA pLKO_005 4198 CDS 100% 13.200 10.560 N Eea1 n/a
6 TRCN0000256424 GCTCATTTGGAGGCTACAATA pLKO_005 1267 CDS 100% 13.200 10.560 N Eea1 n/a
7 TRCN0000093383 CTGCTGTATTAGATTTGGAAA pLKO.1 3134 CDS 100% 4.950 3.960 N Eea1 n/a
8 TRCN0000379603 AGACTTAGAAGGCCACATTAA pLKO_005 2658 CDS 100% 13.200 9.240 N Eea1 n/a
9 TRCN0000256423 CACCGTTCCTCTTAACTATTA pLKO_005 6724 3UTR 100% 13.200 9.240 N Eea1 n/a
10 TRCN0000093380 CGCAGCTTGACATACAGATTA pLKO.1 2393 CDS 100% 13.200 9.240 N Eea1 n/a
11 TRCN0000093381 GCGAAGCTGCATTCTGAAATA pLKO.1 4126 CDS 100% 13.200 9.240 N Eea1 n/a
12 TRCN0000256422 GCGCTTCAAGGAGAGGTTAAA pLKO_005 3409 CDS 100% 13.200 9.240 N Eea1 n/a
13 TRCN0000256426 CAAGCCGCCAAAGCTAGTTTG pLKO_005 3721 CDS 100% 10.800 7.560 N Eea1 n/a
14 TRCN0000093382 CGCACAAACAAGAAAGCATAA pLKO.1 3926 CDS 100% 10.800 7.560 N Eea1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.