Transcript: Mouse XM_006513616.2

PREDICTED: Mus musculus IKAROS family zinc finger 4 (Ikzf4), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ikzf4 (22781)
Length:
5063
CDS:
400..1854

Additional Resources:

NCBI RefSeq record:
XM_006513616.2
NBCI Gene record:
Ikzf4 (22781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096459 CCCTGACCGATTTGAGCATTT pLKO.1 2024 3UTR 100% 10.800 15.120 N Ikzf4 n/a
2 TRCN0000096460 GCCAACTTTCATTGATCGTTT pLKO.1 1020 CDS 100% 4.950 6.930 N Ikzf4 n/a
3 TRCN0000096463 GATAAGGATGACAGTGTGATT pLKO.1 454 CDS 100% 4.950 3.465 N Ikzf4 n/a
4 TRCN0000096461 CCACAGAAGTTTGTAGGTGAA pLKO.1 1075 CDS 100% 4.050 2.835 N Ikzf4 n/a
5 TRCN0000096462 CGGCCAACTTTCATTGATCGT pLKO.1 1018 CDS 100% 2.640 1.848 N Ikzf4 n/a
6 TRCN0000274800 ACCGGCAAGGGAAGGATAATC pLKO_005 255 5UTR 100% 13.200 10.560 N IKZF4 n/a
7 TRCN0000274797 CCTTAGCTCTGTGGCATTATA pLKO_005 2392 3UTR 100% 15.000 10.500 N IKZF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.