Transcript: Mouse XM_006513753.1

PREDICTED: Mus musculus transmembrane and coiled coil domains 3 (Tmcc3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmcc3 (319880)
Length:
5760
CDS:
496..1836

Additional Resources:

NCBI RefSeq record:
XM_006513753.1
NBCI Gene record:
Tmcc3 (319880)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126784 CCGTGCTATGTGTTTCAGATA pLKO.1 5504 3UTR 100% 4.950 6.930 N Tmcc3 n/a
2 TRCN0000126785 GCAGCGATGACGAATGTTCTA pLKO.1 1157 CDS 100% 4.950 6.930 N Tmcc3 n/a
3 TRCN0000297218 AGAGCTACGTGCGGTGTAAAT pLKO_005 1951 3UTR 100% 13.200 9.240 N Tmcc3 n/a
4 TRCN0000279516 AGCTCAAAGGACATCTCTAAA pLKO_005 853 CDS 100% 13.200 9.240 N Tmcc3 n/a
5 TRCN0000126788 GTGCAGTTTAAGAGAGAATAT pLKO.1 1339 CDS 100% 13.200 9.240 N Tmcc3 n/a
6 TRCN0000346481 TGAAGGATGCCCACGTGAAAT pLKO_005 902 CDS 100% 13.200 9.240 N Tmcc3 n/a
7 TRCN0000279555 TGCCAACTTGATCCGGAATAA pLKO_005 1020 CDS 100% 13.200 9.240 N Tmcc3 n/a
8 TRCN0000346335 TGTGACTCTTCTCGCCATATT pLKO_005 1758 CDS 100% 13.200 9.240 N Tmcc3 n/a
9 TRCN0000126786 CTGTGACTCTTCTCGCCATAT pLKO.1 1757 CDS 100% 10.800 7.560 N Tmcc3 n/a
10 TRCN0000126787 CTCAGGGAGATCGAACAGAAT pLKO.1 820 CDS 100% 4.950 3.465 N Tmcc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.