Transcript: Mouse XM_006513766.3

PREDICTED: Mus musculus methionine sulfoxide reductase B3 (Msrb3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Msrb3 (320183)
Length:
2734
CDS:
84..629

Additional Resources:

NCBI RefSeq record:
XM_006513766.3
NBCI Gene record:
Msrb3 (320183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414057 GAAGCTATAAGGGCAGTTTAT pLKO_005 723 3UTR 100% 13.200 18.480 N Msrb3 n/a
2 TRCN0000085622 GATACTGCATCAACTCAGCAT pLKO.1 514 CDS 100% 2.640 3.696 N Msrb3 n/a
3 TRCN0000414495 AGTTCTGCCCATCCATGTATT pLKO_005 814 3UTR 100% 13.200 9.240 N Msrb3 n/a
4 TRCN0000419918 CAGAAGGAAGCGGCATCAAAG pLKO_005 568 CDS 100% 10.800 7.560 N Msrb3 n/a
5 TRCN0000426589 TAGATTGCTAGGCTGCGATAA pLKO_005 1107 3UTR 100% 10.800 7.560 N Msrb3 n/a
6 TRCN0000085619 CATCGAGTTCACAGATGACTT pLKO.1 398 CDS 100% 4.950 3.465 N Msrb3 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2707 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.