Transcript: Mouse XM_006513850.3

PREDICTED: Mus musculus N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits (Gnptab), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Gnptab (432486)
Length:
4739
CDS:
1351..3255

Additional Resources:

NCBI RefSeq record:
XM_006513850.3
NBCI Gene record:
Gnptab (432486)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243581 GCGCCATGGGTACGGAATATT pLKO_005 653 5UTR 100% 15.000 21.000 N Gnptab n/a
2 TRCN0000217630 GAACGCAACCACGATCTATTT pLKO.1 1365 CDS 100% 13.200 18.480 N Gnptab n/a
3 TRCN0000243584 GAACGCAACCACGATCTATTT pLKO_005 1365 CDS 100% 13.200 18.480 N Gnptab n/a
4 TRCN0000243582 GCGTACTAGCAACGTTGATTA pLKO_005 3125 CDS 100% 13.200 18.480 N Gnptab n/a
5 TRCN0000215824 CATGATTGACAGGATCGTTAT pLKO.1 2361 CDS 100% 10.800 15.120 N Gnptab n/a
6 TRCN0000243583 AGATCCACAAAGCCTATAAAG pLKO_005 2783 CDS 100% 13.200 9.240 N Gnptab n/a
7 TRCN0000243580 GTGCTGCTCACCGGATGTAAT pLKO_005 3960 3UTR 100% 13.200 9.240 N Gnptab n/a
8 TRCN0000179385 GCCTACTTGACAACAGACAAA pLKO.1 263 5UTR 100% 4.950 3.465 N Gnptab n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.