Transcript: Mouse XM_006514129.3

PREDICTED: Mus musculus AT rich interactive domain 5B (MRF1-like) (Arid5b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arid5b (71371)
Length:
8544
CDS:
919..4563

Additional Resources:

NCBI RefSeq record:
XM_006514129.3
NBCI Gene record:
Arid5b (71371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514129.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231325 ATGCTCTGTAAGGTGATATTT pLKO_005 8254 3UTR 100% 15.000 21.000 N LOC100044968 n/a
2 TRCN0000234133 TATCCAGCTCGAAACTTTATT pLKO_005 27 5UTR 100% 15.000 21.000 N Arid5b n/a
3 TRCN0000231324 TGGTCTAGTCTGACTTATTAT pLKO_005 7988 3UTR 100% 15.000 21.000 N LOC100044968 n/a
4 TRCN0000111954 GCCGAAGAATAACCACAATAA pLKO.1 1875 CDS 100% 13.200 18.480 N Arid5b n/a
5 TRCN0000218504 GAGAAGATCCACGTCAATTAT pLKO_005 3625 CDS 100% 15.000 12.000 N Arid5b n/a
6 TRCN0000231322 CATTGGCTGAGAAGGACATTT pLKO_005 7270 3UTR 100% 13.200 10.560 N LOC100044968 n/a
7 TRCN0000231323 CAAGGTGGTCCCACGAAATAT pLKO_005 7873 3UTR 100% 15.000 10.500 N LOC100044968 n/a
8 TRCN0000111953 CGTCAGTGGAAACATATTTAT pLKO.1 2113 CDS 100% 15.000 10.500 N Arid5b n/a
9 TRCN0000231326 GAATGCTGAGCCAACTATAAA pLKO_005 8367 3UTR 100% 15.000 10.500 N LOC100044968 n/a
10 TRCN0000151040 GCCTTCAAAGAGAACCATTTA pLKO.1 7908 3UTR 100% 13.200 9.240 N ARID5B n/a
11 TRCN0000111951 GCCCTGTATAAATACATGAAA pLKO.1 1978 CDS 100% 5.625 3.938 N Arid5b n/a
12 TRCN0000111950 CCATCCGTAATCCAACATGTT pLKO.1 3241 CDS 100% 4.950 3.465 N Arid5b n/a
13 TRCN0000111952 CCCAAGATACATCTGAGGTTT pLKO.1 2381 CDS 100% 4.950 3.465 N Arid5b n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1066 CDS 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514129.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.