Transcript: Mouse XM_006514131.3

PREDICTED: Mus musculus AT rich interactive domain 5B (MRF1-like) (Arid5b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arid5b (71371)
Length:
7250
CDS:
261..3269

Additional Resources:

NCBI RefSeq record:
XM_006514131.3
NBCI Gene record:
Arid5b (71371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514131.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231325 ATGCTCTGTAAGGTGATATTT pLKO_005 6960 3UTR 100% 15.000 21.000 N LOC100044968 n/a
2 TRCN0000231324 TGGTCTAGTCTGACTTATTAT pLKO_005 6694 3UTR 100% 15.000 21.000 N LOC100044968 n/a
3 TRCN0000111954 GCCGAAGAATAACCACAATAA pLKO.1 581 CDS 100% 13.200 18.480 N Arid5b n/a
4 TRCN0000218504 GAGAAGATCCACGTCAATTAT pLKO_005 2331 CDS 100% 15.000 12.000 N Arid5b n/a
5 TRCN0000231322 CATTGGCTGAGAAGGACATTT pLKO_005 5976 3UTR 100% 13.200 10.560 N LOC100044968 n/a
6 TRCN0000231323 CAAGGTGGTCCCACGAAATAT pLKO_005 6579 3UTR 100% 15.000 10.500 N LOC100044968 n/a
7 TRCN0000111953 CGTCAGTGGAAACATATTTAT pLKO.1 819 CDS 100% 15.000 10.500 N Arid5b n/a
8 TRCN0000231326 GAATGCTGAGCCAACTATAAA pLKO_005 7073 3UTR 100% 15.000 10.500 N LOC100044968 n/a
9 TRCN0000151040 GCCTTCAAAGAGAACCATTTA pLKO.1 6614 3UTR 100% 13.200 9.240 N ARID5B n/a
10 TRCN0000111951 GCCCTGTATAAATACATGAAA pLKO.1 684 CDS 100% 5.625 3.938 N Arid5b n/a
11 TRCN0000111950 CCATCCGTAATCCAACATGTT pLKO.1 1947 CDS 100% 4.950 3.465 N Arid5b n/a
12 TRCN0000111952 CCCAAGATACATCTGAGGTTT pLKO.1 1087 CDS 100% 4.950 3.465 N Arid5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514131.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.