Transcript: Mouse XM_006514230.3

PREDICTED: Mus musculus BTB (POZ) domain containing 11 (Btbd11), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Btbd11 (74007)
Length:
5474
CDS:
559..3531

Additional Resources:

NCBI RefSeq record:
XM_006514230.3
NBCI Gene record:
Btbd11 (74007)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241371 GTCTCGTAGTTTCGAATATAT pLKO_005 4074 3UTR 100% 15.000 21.000 N Btbd11 n/a
2 TRCN0000241369 ATGCGAAGCACCACGGTAATG pLKO_005 1901 CDS 100% 10.800 15.120 N Btbd11 n/a
3 TRCN0000202477 GCGTACTGTGAAGGCTACTTT pLKO.1 3346 CDS 100% 5.625 7.875 N Btbd11 n/a
4 TRCN0000202174 CGTGAAGTATCCCATCTTCCA pLKO.1 3117 CDS 100% 2.640 2.112 N Btbd11 n/a
5 TRCN0000241370 CCCTGATGTTTGAGATCTTAA pLKO_005 2816 CDS 100% 13.200 9.240 N Btbd11 n/a
6 TRCN0000138705 GCAGCGACACTGTGAGATTAT pLKO.1 3246 CDS 100% 13.200 9.240 N BTBD11 n/a
7 TRCN0000241368 GCTTCACGAAGCGCCCAAATT pLKO_005 1590 CDS 100% 13.200 9.240 N Btbd11 n/a
8 TRCN0000137962 GAGATCATGGAGCTTCTGTCT pLKO.1 3196 CDS 100% 2.640 1.848 N BTBD11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.