Transcript: Mouse XM_006514276.3

PREDICTED: Mus musculus coiled-coil domain containing 6 (Ccdc6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc6 (76551)
Length:
2640
CDS:
423..1661

Additional Resources:

NCBI RefSeq record:
XM_006514276.3
NBCI Gene record:
Ccdc6 (76551)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262121 CAGCTCAAGCAGACCTATATC pLKO_005 1481 CDS 100% 13.200 18.480 N Ccdc6 n/a
2 TRCN0000262120 TAGAGCTGGAGACCTACAAAC pLKO_005 625 CDS 100% 10.800 7.560 N Ccdc6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07195 pDONR223 100% 75.9% 84.2% None (many diffs) n/a
2 ccsbBroad304_07195 pLX_304 0% 75.9% 84.2% V5 (many diffs) n/a
3 TRCN0000478109 CATGATCTCCTACGGATAAGACCT pLX_317 22.3% 75.9% 84.2% V5 (many diffs) n/a
Download CSV