Transcript: Mouse XM_006514447.3

PREDICTED: Mus musculus SMEK homolog 2, suppressor of mek1 (Dictyostelium) (Smek2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp4r3b (104570)
Length:
5137
CDS:
717..2891

Additional Resources:

NCBI RefSeq record:
XM_006514447.3
NBCI Gene record:
Ppp4r3b (104570)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366119 TCGCTTTATGAGGCGAATAAT pLKO_005 2105 CDS 100% 15.000 21.000 N Ppp4r3b n/a
2 TRCN0000374655 TGAACAGTGTACCATCTATAT pLKO_005 2401 CDS 100% 13.200 18.480 N Ppp4r3b n/a
3 TRCN0000183123 CGATTGAATATGTTCAGACAT pLKO.1 2326 CDS 100% 4.950 6.930 N PPP4R3B n/a
4 TRCN0000176665 CTAATGGAACAAACAGTACAA pLKO.1 2680 CDS 100% 4.950 6.930 N Ppp4r3b n/a
5 TRCN0000217122 CTTCGCTTTATGAGGCGAATA pLKO.1 2103 CDS 100% 1.080 1.512 N Ppp4r3b n/a
6 TRCN0000178223 GCCAGAAACTAGTCATCTAAT pLKO.1 1091 CDS 100% 0.000 0.000 N Ppp4r3b n/a
7 TRCN0000215466 GATCAGCTGCTACAGATATAT pLKO.1 1567 CDS 100% 15.000 10.500 N Ppp4r3b n/a
8 TRCN0000215574 GATGAAGAAATGTGGTTTAAT pLKO.1 2466 CDS 100% 15.000 10.500 N Ppp4r3b n/a
9 TRCN0000366121 GGGACTTCTTCGTACTCTAAT pLKO_005 1742 CDS 100% 13.200 9.240 N Ppp4r3b n/a
10 TRCN0000374609 TGAGACTTCAGTACCCAATAA pLKO_005 3220 3UTR 100% 13.200 9.240 N Ppp4r3b n/a
11 TRCN0000178194 CAGAGTGATGATGATGTACTT pLKO.1 1650 CDS 100% 4.950 3.465 N Ppp4r3b n/a
12 TRCN0000182853 CCCAACAAGGAAAGGCTCATA pLKO.1 3148 3UTR 100% 4.950 3.465 N Ppp4r3b n/a
13 TRCN0000181552 GCAGTCATAACACCAGTTGAA pLKO.1 2511 CDS 100% 4.950 3.465 N Ppp4r3b n/a
14 TRCN0000182613 GCCAGGTAGGAAAGTGTAGTT pLKO.1 3021 3UTR 100% 4.950 3.465 N Ppp4r3b n/a
15 TRCN0000149294 GCTGTTCAGTTAATGGGACTT pLKO.1 1728 CDS 100% 4.050 2.835 N PPP4R3B n/a
16 TRCN0000374551 ACATCACACATACCACATAAA pLKO_005 2000 CDS 100% 13.200 7.920 N Ppp4r3b n/a
17 TRCN0000216168 CAGAAACAGCAGGATACATTA pLKO.1 903 CDS 100% 13.200 7.920 N Ppp4r3b n/a
18 TRCN0000181536 GCTTGGATCTAACACAACCAA pLKO.1 1904 CDS 100% 3.000 1.800 N Ppp4r3b n/a
19 TRCN0000143232 GAAGAGGAAGATGAGGAAGAA pLKO.1 2832 CDS 100% 4.950 2.475 Y ARMH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.