Transcript: Mouse XM_006514505.2

PREDICTED: Mus musculus B cell CLL/lymphoma 11A (zinc finger protein) (Bcl11a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bcl11a (14025)
Length:
6000
CDS:
224..2731

Additional Resources:

NCBI RefSeq record:
XM_006514505.2
NBCI Gene record:
Bcl11a (14025)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514505.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033453 GCATAGACGATGGCACTGTTA pLKO.1 2010 CDS 100% 4.950 6.930 N BCL11A n/a
2 TRCN0000033452 GCGGTTGAATCCAATGGCTAT pLKO.1 1126 CDS 100% 4.050 5.670 N BCL11A n/a
3 TRCN0000096552 GCACTTAAGCAAACGGGAATT pLKO.1 253 CDS 100% 0.000 0.000 N Bcl11a n/a
4 TRCN0000096551 CCGCAGGGTATTTGTAAAGAT pLKO.1 698 CDS 100% 5.625 4.500 N Bcl11a n/a
5 TRCN0000448972 ACAGAACACTCATGGATTAAG pLKO_005 790 CDS 100% 13.200 9.240 N Bcl11a n/a
6 TRCN0000359207 ACCTCTCCATGGGATTCATAT pLKO_005 898 CDS 100% 13.200 9.240 N BCL11A n/a
7 TRCN0000033451 CCAGAGGATGACGATTGTTTA pLKO.1 542 CDS 100% 13.200 9.240 N BCL11A n/a
8 TRCN0000096550 GCCAGAGGATGACGATTGTTT pLKO.1 541 CDS 100% 5.625 3.938 N Bcl11a n/a
9 TRCN0000096553 CACAAACGGAAACAATGCAAT pLKO.1 419 CDS 100% 4.950 3.465 N Bcl11a n/a
10 TRCN0000033449 CGCACAGAACACTCATGGATT pLKO.1 787 CDS 100% 4.950 3.465 N BCL11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514505.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.