Transcript: Mouse XM_006514617.2

PREDICTED: Mus musculus phosphoinositide-3-kinase interacting protein 1 (Pik3ip1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pik3ip1 (216505)
Length:
1479
CDS:
356..847

Additional Resources:

NCBI RefSeq record:
XM_006514617.2
NBCI Gene record:
Pik3ip1 (216505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514617.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249989 ATTATCGTGGGCTACACTTAC pLKO_005 617 CDS 100% 10.800 15.120 N Pik3ip1 n/a
2 TRCN0000249991 TACGTGCTGGGCATTACTATG pLKO_005 566 CDS 100% 10.800 15.120 N Pik3ip1 n/a
3 TRCN0000379268 AGGAACTTGAGTGGCATATAC pLKO_005 1237 3UTR 100% 13.200 10.560 N Pik3ip1 n/a
4 TRCN0000249990 TGGTGATCATCCTCGCTATTG pLKO_005 588 CDS 100% 10.800 8.640 N Pik3ip1 n/a
5 TRCN0000184737 CCATTCGTCATCCAGGAACTT pLKO.1 1224 3UTR 100% 4.950 3.465 N Pik3ip1 n/a
6 TRCN0000179290 GAAAGAGCAACATGAGAAGAA pLKO.1 655 CDS 100% 4.950 3.465 N Pik3ip1 n/a
7 TRCN0000345857 CATGAGAAGAAAGCGTGTGAG pLKO_005 665 CDS 100% 4.050 2.835 N Pik3ip1 n/a
8 TRCN0000375598 GAGATGCAGCGAATCACCTTG pLKO_005 689 CDS 100% 4.050 2.835 N Pik3ip1 n/a
9 TRCN0000184438 GCTGGGCATTACTATGATGGT pLKO.1 571 CDS 100% 2.640 1.848 N Pik3ip1 n/a
10 TRCN0000375597 TGGTGCACCAGGTGACAAAGA pLKO_005 415 CDS 100% 4.950 2.970 N Pik3ip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514617.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.