Transcript: Mouse XM_006514845.3

PREDICTED: Mus musculus myotubularin related protein 3 (Mtmr3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mtmr3 (74302)
Length:
5859
CDS:
342..3959

Additional Resources:

NCBI RefSeq record:
XM_006514845.3
NBCI Gene record:
Mtmr3 (74302)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514845.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276937 GCGTTGAATGCCGTGATATAT pLKO_005 574 CDS 100% 15.000 21.000 N Mtmr3 n/a
2 TRCN0000030093 CCAATGGGCATTGTGCCAATT pLKO.1 3196 CDS 100% 10.800 15.120 N Mtmr3 n/a
3 TRCN0000030092 CCCGTTGTACTTTACCAAGAA pLKO.1 2541 CDS 100% 4.950 6.930 N Mtmr3 n/a
4 TRCN0000030091 CTGCGCTTCAATGGAGACTTT pLKO.1 3528 CDS 100% 4.950 6.930 N Mtmr3 n/a
5 TRCN0000276938 CTCCTACTTGACCCTTATTAC pLKO_005 1626 CDS 100% 13.200 10.560 N Mtmr3 n/a
6 TRCN0000285813 GATGTACCACTGGATTGTAAA pLKO_005 4087 3UTR 100% 13.200 10.560 N Mtmr3 n/a
7 TRCN0000276939 TTGTGCCTTGCCGTTAGATAA pLKO_005 3077 CDS 100% 13.200 9.240 N Mtmr3 n/a
8 TRCN0000030090 GCAGGCAACAAGGCTTTCAAA pLKO.1 1965 CDS 100% 5.625 3.938 N Mtmr3 n/a
9 TRCN0000276994 GCAGGCAACAAGGCTTTCAAA pLKO_005 1965 CDS 100% 5.625 3.938 N Mtmr3 n/a
10 TRCN0000003017 GCATTGACCTTGAACTGGATA pLKO.1 3913 CDS 100% 4.950 3.465 N MTMR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514845.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.