Transcript: Mouse XM_006514933.2

PREDICTED: Mus musculus adenylate cyclase 3 (Adcy3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adcy3 (104111)
Length:
4965
CDS:
963..4400

Additional Resources:

NCBI RefSeq record:
XM_006514933.2
NBCI Gene record:
Adcy3 (104111)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514933.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114969 CCTCTACCTGTGTGCTATCAT pLKO.1 1655 CDS 100% 5.625 7.875 N Adcy3 n/a
2 TRCN0000114968 GCCATCTTTCCCAGGTCATTT pLKO.1 3000 CDS 100% 13.200 9.240 N Adcy3 n/a
3 TRCN0000432373 TCGAAACCTACCTCATCATTG pLKO_005 2422 CDS 100% 10.800 7.560 N Adcy3 n/a
4 TRCN0000114966 CCAGTCATTCAACAACTTCAT pLKO.1 4061 CDS 100% 4.950 3.465 N Adcy3 n/a
5 TRCN0000114967 GCAGCAGTTCAATACCATGTA pLKO.1 1874 CDS 100% 4.950 3.465 N Adcy3 n/a
6 TRCN0000114970 GCCATGGTGGAGATACTCATT pLKO.1 2898 CDS 100% 4.950 3.465 N Adcy3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514933.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00024 pDONR223 100% 89.7% 94.4% None (many diffs) n/a
2 ccsbBroad304_00024 pLX_304 0% 89.7% 94.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV