Transcript: Mouse XM_006515051.2

PREDICTED: Mus musculus TATA-box binding protein associated factor, RNA polymerase I, B (Taf1b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Taf1b (21340)
Length:
1760
CDS:
567..1568

Additional Resources:

NCBI RefSeq record:
XM_006515051.2
NBCI Gene record:
Taf1b (21340)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233978 CGATAAGTCCGTCGCATATAA pLKO_005 1115 CDS 100% 15.000 21.000 N Taf1b n/a
2 TRCN0000082163 CGTCGCATATAAGAGAAGAAA pLKO.1 1124 CDS 100% 5.625 7.875 N Taf1b n/a
3 TRCN0000218937 ACGTTTGATCCTATAGCTAAA pLKO_005 822 CDS 100% 10.800 8.640 N Taf1b n/a
4 TRCN0000233977 GACTATGAAGACATCTATAAA pLKO_005 618 CDS 100% 15.000 10.500 N Taf1b n/a
5 TRCN0000233976 AGGATCATATTCCGTACATAA pLKO_005 520 5UTR 100% 13.200 9.240 N Taf1b n/a
6 TRCN0000082165 CCTGATGAAATGCACACTTTA pLKO.1 753 CDS 100% 13.200 9.240 N Taf1b n/a
7 TRCN0000218410 TTAACCTGTCAAGTAGTAAAG pLKO_005 771 CDS 100% 10.800 7.560 N Taf1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.