Transcript: Mouse XM_006515077.3

PREDICTED: Mus musculus cDNA sequence BC068281 (BC068281), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdcp (238037)
Length:
3179
CDS:
173..2305

Additional Resources:

NCBI RefSeq record:
XM_006515077.3
NBCI Gene record:
Wdcp (238037)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515077.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423771 CCAATACGTGTAACGTAATTT pLKO_005 1221 CDS 100% 15.000 21.000 N Wdcp n/a
2 TRCN0000413997 CCGACTTCACTGCTTTGTTAA pLKO_005 1494 CDS 100% 13.200 18.480 N Wdcp n/a
3 TRCN0000180145 CGTGTCATTGGAAGGTTTGAA pLKO.1 326 CDS 100% 5.625 7.875 N Wdcp n/a
4 TRCN0000180426 GACAGCAACCTTCATTCGTAT pLKO.1 698 CDS 100% 4.950 6.930 N Wdcp n/a
5 TRCN0000433293 GGGAACTCGCAGGTTGCTATA pLKO_005 809 CDS 100% 10.800 8.640 N Wdcp n/a
6 TRCN0000180692 GCTCCATATGTTCACCTCATT pLKO.1 1943 CDS 100% 0.000 0.000 N Wdcp n/a
7 TRCN0000181143 CAAGCTGAACAGAGTTCTCTT pLKO.1 1028 CDS 100% 4.950 3.465 N Wdcp n/a
8 TRCN0000412387 CATAAGCTTTGTAGCTTAAAT pLKO_005 848 CDS 100% 1.500 1.050 N Wdcp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515077.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.