Transcript: Mouse XM_006515167.3

PREDICTED: Mus musculus membrane bound O-acyltransferase domain containing 2 (Mboat2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mboat2 (67216)
Length:
6805
CDS:
273..1565

Additional Resources:

NCBI RefSeq record:
XM_006515167.3
NBCI Gene record:
Mboat2 (67216)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515167.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248020 CAGATTACTAGAGTCTATATC pLKO_005 345 CDS 100% 13.200 18.480 N Mboat2 n/a
2 TRCN0000248023 GACCTTAGCTGACGCCATTAA pLKO_005 878 CDS 100% 13.200 10.560 N Mboat2 n/a
3 TRCN0000217116 CAGGCCCAATGATGATCATTA pLKO.1 397 CDS 100% 13.200 9.240 N Mboat2 n/a
4 TRCN0000248024 CAGGCCCAATGATGATCATTA pLKO_005 397 CDS 100% 13.200 9.240 N Mboat2 n/a
5 TRCN0000370670 CAGGCCCAATGATGATCATTA pLKO_005 397 CDS 100% 13.200 9.240 N MBOAT2 n/a
6 TRCN0000248022 GACGATTTCAGTATTCGATAT pLKO_005 1988 3UTR 100% 10.800 7.560 N Mboat2 n/a
7 TRCN0000174368 CCTTACACTTTCTTGTACAAA pLKO.1 232 5UTR 100% 5.625 3.938 N Mboat2 n/a
8 TRCN0000175588 CCAAATGAATGTCTTGCCTTA pLKO.1 1912 3UTR 100% 4.050 2.835 N Mboat2 n/a
9 TRCN0000194479 GCTTTGTGTTTGCTTTGGGAT pLKO.1 310 CDS 100% 2.640 1.848 N Mboat2 n/a
10 TRCN0000370550 TTTACAGCTCCTGGTATTATT pLKO_005 1333 CDS 100% 15.000 10.500 N MBOAT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515167.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.