Transcript: Mouse XM_006515276.2

PREDICTED: Mus musculus histone deacetylase 9 (Hdac9), transcript variant X29, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Hdac9 (79221)
Length:
4000
CDS:
42..1670

Additional Resources:

NCBI RefSeq record:
XM_006515276.2
NBCI Gene record:
Hdac9 (79221)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193363 CCTTCTGATAATTTGACACAT pLKO.1 3386 3UTR 100% 4.950 6.930 N Hdac9 n/a
2 TRCN0000004858 GCAAAGATAGAGGACGAGAAA pLKO.1 427 CDS 100% 4.950 6.930 N HDAC9 n/a
3 TRCN0000194057 GCAAAGATAGAGGACGAGAAA pLKO.1 427 CDS 100% 4.950 6.930 N Hdac9 n/a
4 TRCN0000004857 GCAAAGATTTAGCTCCAGGAT pLKO.1 1627 CDS 100% 2.640 3.696 N HDAC9 n/a
5 TRCN0000277837 GCAAAGATTTAGCTCCAGGAT pLKO_005 1627 CDS 100% 2.640 3.696 N HDAC9 n/a
6 TRCN0000174983 GCTCCAGGATTTGTAATTAAA pLKO.1 1638 CDS 100% 15.000 12.000 N Hdac9 n/a
7 TRCN0000196797 GCTCCAGGATTTGTAATTAAA pLKO.1 1638 CDS 100% 15.000 12.000 N HDAC9 n/a
8 TRCN0000277763 GCTCCAGGATTTGTAATTAAA pLKO_005 1638 CDS 100% 15.000 12.000 N HDAC9 n/a
9 TRCN0000004855 CCATCCTACAAGTACACATTA pLKO.1 624 CDS 100% 13.200 10.560 N HDAC9 n/a
10 TRCN0000194159 GCTCAAGATAGCAAGGATGAT pLKO.1 651 CDS 100% 4.950 3.465 N Hdac9 n/a
11 TRCN0000174507 CCAAGTAATCAATAGGCTCTA pLKO.1 1884 3UTR 100% 4.050 2.835 N Hdac9 n/a
12 TRCN0000175012 GAAAGAATTTCACCAGGCATT pLKO.1 1182 CDS 100% 4.050 2.835 N Hdac9 n/a
13 TRCN0000175285 CCTCTGGAACATTTCCTTAAT pLKO.1 2967 3UTR 100% 13.200 7.920 N Hdac9 n/a
14 TRCN0000176073 GAGCACATCAAGGAACTTCTA pLKO.1 294 CDS 100% 4.950 2.970 N Hdac9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.