Transcript: Mouse XM_006515628.3

PREDICTED: Mus musculus SEC23 homolog A, COPII coat complex component (Sec23a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sec23a (20334)
Length:
4115
CDS:
204..2501

Additional Resources:

NCBI RefSeq record:
XM_006515628.3
NBCI Gene record:
Sec23a (20334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515628.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336359 ACCACAACCTTAGCCATATAT pLKO_005 1563 CDS 100% 15.000 12.000 N Sec23a n/a
2 TRCN0000380154 GGACGAGGTGCAGTCCAATTT pLKO_005 1626 CDS 100% 13.200 10.560 N Sec23a n/a
3 TRCN0000381360 GGTTGGACAGACAACTCATTC pLKO_005 1837 CDS 100% 10.800 8.640 N Sec23a n/a
4 TRCN0000065262 CCCTTCACAGACTCATAATAA pLKO.1 2372 CDS 100% 15.000 10.500 N SEC23A n/a
5 TRCN0000336357 ACAAGTGTTCATGGATCATTT pLKO_005 2450 CDS 100% 13.200 9.240 N Sec23a n/a
6 TRCN0000336358 ATGAGCTAAAGACACCTATAA pLKO_005 1114 CDS 100% 13.200 9.240 N Sec23a n/a
7 TRCN0000353393 ATGGCCAGGCTGGCAATATAC pLKO_005 1779 CDS 100% 13.200 9.240 N Sec23a n/a
8 TRCN0000353328 TGATGATATATGGCTAGTTTG pLKO_005 2894 3UTR 100% 10.800 7.560 N Sec23a n/a
9 TRCN0000100892 CCTCCTTCCAATAGATTCTTA pLKO.1 873 CDS 100% 5.625 3.938 N Sec23a n/a
10 TRCN0000100891 GCACCAATTCTCACGGATGAT pLKO.1 2421 CDS 100% 4.950 3.465 N Sec23a n/a
11 TRCN0000100894 CCTACAGCTTTGGTTGGACTT pLKO.1 681 CDS 100% 4.050 2.835 N Sec23a n/a
12 TRCN0000100890 GCATACATTGTATATGCCATT pLKO.1 2951 3UTR 100% 0.405 0.284 N Sec23a n/a
13 TRCN0000100893 CCACCTACATATGCTGGGATA pLKO.1 486 CDS 100% 0.000 0.000 N Sec23a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515628.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.