Transcript: Mouse XM_006515643.3

PREDICTED: Mus musculus dishevelled associated activator of morphogenesis 1 (Daam1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Daam1 (208846)
Length:
5974
CDS:
323..3529

Additional Resources:

NCBI RefSeq record:
XM_006515643.3
NBCI Gene record:
Daam1 (208846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120534 CGTCGTAAGAATGTTGGTTAA pLKO.1 1624 CDS 100% 10.800 15.120 N Daam1 n/a
2 TRCN0000120535 CGGGCAATTCTAACAATGGAT pLKO.1 2426 CDS 100% 3.000 4.200 N Daam1 n/a
3 TRCN0000123000 CGCTATGAATTTCTGATGTTA pLKO.1 1235 CDS 100% 5.625 4.500 N DAAM1 n/a
4 TRCN0000120533 CCTGGCTCATTCTGAGAGTAT pLKO.1 916 CDS 100% 4.950 3.465 N Daam1 n/a
5 TRCN0000120536 CGAAACAATGACCATCCAGAA pLKO.1 377 CDS 100% 4.050 2.835 N Daam1 n/a
6 TRCN0000120532 GCATTCATATTGAGTGGGATT pLKO.1 3784 3UTR 100% 4.050 2.835 N Daam1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.