Transcript: Mouse XM_006515646.2

PREDICTED: Mus musculus pleckstrin homology domain containing, family H (with MyTH4 domain) member 1 (Plekhh1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plekhh1 (211945)
Length:
6427
CDS:
301..4368

Additional Resources:

NCBI RefSeq record:
XM_006515646.2
NBCI Gene record:
Plekhh1 (211945)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515646.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090454 CCGTATTGACAAGTTGACCTT pLKO.1 4173 CDS 100% 2.640 3.696 N Plekhh1 n/a
2 TRCN0000090455 CCACTTCCTCTGGTATGTCAA pLKO.1 3081 CDS 100% 4.950 3.465 N Plekhh1 n/a
3 TRCN0000090457 CACTGTCTATGAGCAGCTCAT pLKO.1 2691 CDS 100% 4.050 2.835 N Plekhh1 n/a
4 TRCN0000090456 CGGGAGTATTTGGAAGTTGGT pLKO.1 274 5UTR 100% 2.640 1.848 N Plekhh1 n/a
5 TRCN0000090453 CCCAACAATGTGTGTGTTGTA pLKO.1 5554 3UTR 100% 0.495 0.347 N Plekhh1 n/a
6 TRCN0000128266 GATGACTTCATGCTTGTGATT pLKO.1 4120 CDS 100% 4.950 2.970 N PLEKHH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515646.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.