Transcript: Mouse XM_006515652.3

PREDICTED: Mus musculus spectrin repeat containing, nuclear envelope family member 3 (Syne3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Syne3 (212073)
Length:
5282
CDS:
123..3050

Additional Resources:

NCBI RefSeq record:
XM_006515652.3
NBCI Gene record:
Syne3 (212073)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515652.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283060 CCGTGTAGACCGGTTACAAAC pLKO_005 1292 CDS 100% 10.800 15.120 N Syne3 n/a
2 TRCN0000264484 CGCTCATGCTTCGGTACAATG pLKO_005 3013 CDS 100% 10.800 15.120 N Syne3 n/a
3 TRCN0000264483 CTACGTAGAATCATCACAATG pLKO_005 2586 CDS 100% 10.800 15.120 N Syne3 n/a
4 TRCN0000283064 TTGGGCCGTGGGCTAGATAAA pLKO_005 3545 3UTR 100% 13.200 10.560 N Syne3 n/a
5 TRCN0000264485 TGCTGCACAACGTGGACAATC pLKO_005 598 CDS 100% 10.800 7.560 N Syne3 n/a
6 TRCN0000183429 CATTCAGGAATACCAAAGTAT pLKO.1 1376 CDS 100% 5.625 3.938 N Syne3 n/a
7 TRCN0000184785 CCTGAGTTCCATGACCTGAAT pLKO.1 5023 3UTR 100% 4.950 3.465 N Syne3 n/a
8 TRCN0000196022 GCAGGTGTTCACCAACAACAT pLKO.1 2417 CDS 100% 4.950 3.465 N Syne3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515652.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.