Transcript: Mouse XM_006515821.3

PREDICTED: Mus musculus A kinase (PRKA) anchor protein 6 (Akap6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Akap6 (238161)
Length:
15048
CDS:
324..7250

Additional Resources:

NCBI RefSeq record:
XM_006515821.3
NBCI Gene record:
Akap6 (238161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515821.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363488 AGGATATTTGCGAGGATATTT pLKO_005 652 CDS 100% 15.000 21.000 N Akap6 n/a
2 TRCN0000088750 CCTCAAACAAACGGAGGTGTT pLKO.1 2222 CDS 100% 4.050 5.670 N Akap6 n/a
3 TRCN0000363530 AGTTGGTTGACATCCTATAAG pLKO_005 5106 CDS 100% 13.200 10.560 N Akap6 n/a
4 TRCN0000088751 CGCCGAGAAACAACTCCAATA pLKO.1 3659 CDS 100% 10.800 8.640 N Akap6 n/a
5 TRCN0000088752 GCCTGGTCCTTGTGAAATGAT pLKO.1 1403 CDS 100% 5.625 4.500 N Akap6 n/a
6 TRCN0000363471 CCAAATTGATGGTCCATTAAA pLKO_005 7599 3UTR 100% 15.000 10.500 N Akap6 n/a
7 TRCN0000088748 CCCTTGATTTGATTGTAGTAT pLKO.1 7737 3UTR 100% 5.625 3.938 N Akap6 n/a
8 TRCN0000088749 GCCTTTCACTACCAAATGATA pLKO.1 3397 CDS 100% 5.625 3.938 N Akap6 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 11376 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 11406 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515821.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.