Transcript: Mouse XM_006515854.3

PREDICTED: Mus musculus solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 (Slc24a4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc24a4 (238384)
Length:
3780
CDS:
740..2551

Additional Resources:

NCBI RefSeq record:
XM_006515854.3
NBCI Gene record:
Slc24a4 (238384)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515854.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069973 GCGTTCATATACGATGAGGAA pLKO.1 1394 CDS 100% 2.640 3.696 N Slc24a4 n/a
2 TRCN0000069975 CCTTGGTATTCACCTCAACAA pLKO.1 2401 CDS 100% 4.950 3.960 N Slc24a4 n/a
3 TRCN0000069976 CGGAAGCAACGTGTTTGATAT pLKO.1 2251 CDS 100% 13.200 9.240 N Slc24a4 n/a
4 TRCN0000415589 TCTCCATAATGATAGAGTTTA pLKO_005 2484 CDS 100% 13.200 9.240 N SLC24A4 n/a
5 TRCN0000069974 CCTGTGCTTCTCCATAATGAT pLKO.1 2476 CDS 100% 5.625 3.938 N Slc24a4 n/a
6 TRCN0000069977 GCTGTGTTCAACATCCTATGT pLKO.1 1268 CDS 100% 4.950 2.970 N Slc24a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515854.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.