Transcript: Mouse XM_006516187.4

PREDICTED: Mus musculus coiled-coil domain containing 88C (Ccdc88c), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ccdc88c (68339)
Length:
9140
CDS:
2043..7853

Additional Resources:

NCBI RefSeq record:
XM_006516187.4
NBCI Gene record:
Ccdc88c (68339)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516187.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216299 GCAGTACATAGACAAGTTAAA pLKO.1 5900 CDS 100% 13.200 10.560 N Ccdc88c n/a
2 TRCN0000248016 GCAGTACATAGACAAGTTAAA pLKO_005 5900 CDS 100% 13.200 10.560 N Ccdc88c n/a
3 TRCN0000192823 GATCGTAATGAATTTGCCCAA pLKO.1 2111 CDS 100% 2.160 1.728 N Ccdc88c n/a
4 TRCN0000248015 AGATTGAGCTGCAGATGATAA pLKO_005 4789 CDS 100% 13.200 9.240 N Ccdc88c n/a
5 TRCN0000192141 GCAGCTGATCGTAATGAATTT pLKO.1 2105 CDS 100% 13.200 9.240 N Ccdc88c n/a
6 TRCN0000248018 GGCCGCACCAAAGGTTGTAAT pLKO_005 6414 CDS 100% 13.200 9.240 N Ccdc88c n/a
7 TRCN0000248019 GAGCCAAAGCCCTAGTCAAAC pLKO_005 6016 CDS 100% 10.800 7.560 N Ccdc88c n/a
8 TRCN0000248017 TCTCCAGCAGCTGATCGTAAT pLKO_005 2099 CDS 100% 10.800 7.560 N Ccdc88c n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8826 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516187.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.