Transcript: Mouse XM_006516443.2

PREDICTED: Mus musculus serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 16 (Serpina16), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Serpina16 (194604)
Length:
1530
CDS:
185..1441

Additional Resources:

NCBI RefSeq record:
XM_006516443.2
NBCI Gene record:
Serpina16 (194604)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516443.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092681 CAGCTACCAAAGTCCAAACTA pLKO.1 353 CDS 100% 5.625 3.938 N Serpina16 n/a
2 TRCN0000092682 CCACACTGGAAGTTTGTTCTT pLKO.1 568 CDS 100% 4.950 3.465 N Serpina16 n/a
3 TRCN0000092679 GCCATTAAGGTCAAGACTCAA pLKO.1 710 CDS 100% 4.950 3.465 N Serpina16 n/a
4 TRCN0000092678 GCTGAAGTATTTCTCCCACAT pLKO.1 916 CDS 100% 4.050 2.835 N Serpina16 n/a
5 TRCN0000092680 CCCAAATTCTCCATACCCGTT pLKO.1 1097 CDS 100% 2.160 1.512 N Serpina16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516443.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.