Transcript: Mouse XM_006516509.3

PREDICTED: Mus musculus pitrilysin metallepetidase 1 (Pitrm1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Pitrm1 (69617)
Length:
2726
CDS:
53..2710

Additional Resources:

NCBI RefSeq record:
XM_006516509.3
NBCI Gene record:
Pitrm1 (69617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516509.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031651 GCCAGCGATTACACGATATAT pLKO.1 470 CDS 100% 15.000 21.000 N Pitrm1 n/a
2 TRCN0000324878 GCCAGCGATTACACGATATAT pLKO_005 470 CDS 100% 15.000 21.000 N Pitrm1 n/a
3 TRCN0000031652 CGGATCAAGAAGTATCTACTA pLKO.1 2351 CDS 100% 4.950 6.930 N Pitrm1 n/a
4 TRCN0000324790 CGGATCAAGAAGTATCTACTA pLKO_005 2351 CDS 100% 4.950 6.930 N Pitrm1 n/a
5 TRCN0000031653 CGTGTATTTGGATGCAACTTT pLKO.1 535 CDS 100% 5.625 4.500 N Pitrm1 n/a
6 TRCN0000031650 CCAGACGACAAGTATTATGAA pLKO.1 1568 CDS 100% 5.625 3.938 N Pitrm1 n/a
7 TRCN0000353949 CCAGACGACAAGTATTATGAA pLKO_005 1568 CDS 100% 5.625 3.938 N Pitrm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516509.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.