Transcript: Mouse XM_006516552.3

PREDICTED: Mus musculus GLI-Kruppel family member GLI3 (Gli3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gli3 (14634)
Length:
7842
CDS:
130..4884

Additional Resources:

NCBI RefSeq record:
XM_006516552.3
NBCI Gene record:
Gli3 (14634)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516552.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096145 CCAATGAGAAACCGTATGTAT pLKO.1 1937 CDS 100% 5.625 7.875 N Gli3 n/a
2 TRCN0000096144 GCAGAATTATTCCGGTCAGTT pLKO.1 4449 CDS 100% 4.950 6.930 N Gli3 n/a
3 TRCN0000096146 CCTTGGTTACAATCCTCAATA pLKO.1 1076 CDS 100% 13.200 10.560 N Gli3 n/a
4 TRCN0000096148 GATGCTAACTTGAATGATGAA pLKO.1 3379 CDS 100% 4.950 3.960 N Gli3 n/a
5 TRCN0000096147 CCACATAATCTGTGGAAGGTT pLKO.1 3736 CDS 100% 0.300 0.240 N Gli3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516552.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.